Document Type : Original researches
Abstract
Keywords
Detection of some virulence and antibiotics resistance genes in Campylobacter isolated from turkeys
Engy Ahmed Hamed, Zainab AbdEl-badiea, Waleed Abdelfatah. Ibrahim, and Mona A. A. AbdelRahman,
Reference Laboratory for Veterinary Quality Control on Poultry production, Animal Health Research Institute, Agricultural Research Center (ARC). Nadi El-Seid Street, Dokki P.O. Box 246, Giza 12618, Egypt.
Abstract
A total of 69 cloacal swabs were collected from turkey from different turkey farms in Giza and Sharkia governorates in Egypt for isolation of Campylobacter species.The results revealed that Campylobacter was isolated from 16 out of 69 (23.1%) cloacal samples. The samples were identified biochemically revealed that 4 out of 16 (25%) were identified as Campylobacter jejuni (C. jejuni) while 12 out of 16 (75%) were Campylobacter coli (C. coli). Campylobacter isolates were confirmed by multiplex PCR using hipO gene which responsible for Na hippurate hydrolysis for confirmation of C. jejuni and ceuE gene which designed for detection of C. coli. All isolates were examined for presence of tetracycline resistance gene tetM was detected in 8 out of 16 (50%) Campylobacter isolates. The cdtB virulence gene was detected in all isolates. From mentioned results we recommended the use of multiplex polymerase chain reaction (PCR) for identification of Campylobacter species. This study may indicate the extent of the existence of campylobacter species in some turkey farms in Giza &Sharkia governorates. In conclusion, biosecurity programs must be applied inside slaughter houses to avoid carcass contamination. Applying more efforts in surveillance programs in turkey farms for epidemiological mapping of Campylobacter existence and antimicrobial resistance distribution which obligate the stop of uncontrollable use of antibiotics in poultry farms.
Key words:
Campylobacter, tetM, Turkey, cdtB
Introduction
Poultry production considered an important source of protein in Egypt and all over the world. It represents about 20% of daily consumption of animal's protein in Egyptian society. Turkey production has a smaller scale of production in comparison to poultry production due to the cost of breeding and the high price of turkey in Egypt. Moreover, turkey need a special condition in production due to its sensitivity to infection with many diseases, its expensive costs of feed, vaccines and treatment. (Moawad et al., 2017)
Poultry and poultry by-products causes about of 20-30 % of human Campylobacter infection (EFSA 2021), through consumption of under cooked food or contaminated food with Campylobacter, the carcass may be contaminated through the production chain of poultry inside slaughter houses (Hamed et al., 2014)
Thermophilic Campylobacter species are Gram negative motile bacilli by single polar flagella, S shape spirally curved bacilli. Mostly colonized normally in intestinal tract of poultry specially chicken and turkey without any pathogenic lesions, but sometimes it causes what is called vibronic hepatitis forming focal spots in the liver which related to infection with Campylobacter jejuni, and Campylobacter coli. Recently, a new species of Campylobacter with name Campylobacter hepaticus was found to be responsible of vibronic hepatitis, a disease which causes high morbidity, mortality, and drop in egg production in layer chickens. Campylobacter jejuni also may cause a gastrointestinal inflammation in chickens and turkeys (Zhage and Sahin 2020).
Campylobacter has four types of virulence genes which play an important role of its pathogenicity inside the host. Moreover, it carries invasion genes (cadF, ciaB, and pldA) genes, adherence genes (cadF), colonization genes (caiB, pldA and dnaJ) which play an important role in colonization in the intestinal tract of host, and the cytolethal toxin genes which are encoded in (cdtA, cdtB, and cdtC) genes responsible for appearance of the lethal symptoms of Campylobacter infection.(Reddy and Zshiri 2018).
Misuse of antibiotics as growth promoters or random use in treatment of any bacterial disease may affect the commensal bacteria in gastrointestinal tract like Campylobacter spp.and may lead to the production of generations carrying antibiotic resistance genes. (Peterson and Kaur 2018; Singh et al., 2019; Hamed et al., 2021). For many years, Campylobacter spp. were considered susceptible to various antimicrobial agents, while in the recent years, both animals and human isolates of this bacterium have shown resistance to several antibiotics such as fluoroquinolones and tetracycline (Iovine 2013).
Due to limited information about presence of Campylobacter spp. in turkey farms, the present study was aimed to detect the incidence of their occurrence, using both conventional method and multiplex PCR , in addition to the presence of cdtB & tetM genes.
Materials and methods
Sampling
A total of 69 cloacal swabs were collected from apparent healthy turkey in turkey farms in Sharkia and Giza governorates. All samples were kept on Cary-Blair Medium (Oxoid) as transport media and submitted to Reference lab for veterinary quality control on poultry production for isolation of Campylobacter spp.
Isolation and identification of Campylobacter
Campylobacter spp. isolation and identification was done by standard methods according to (ISO 10272-1:2017). Samples were added to Bolton broth (1:9 v/v) as 1g to 9 ml of Bolton broth, incubated at 37 ̊C for 4 hrs then at 44 ̊C for 44 hrs then inoculated in selective agar plates mCCDA incubated at 41.5 ̊C for 48 hrs. The select the suspected colonies (metallic gray colonies) were subjected to Gram staining and examined under Microscope to see the specific shape of Campylobacter (curved gram negative bacilli).
Biochemical identification
For differentiations of thermophilic Campylobacter spp. biochemical tests of Na hippurate hydrolysis test, oxidase test and catalase test were used according to (ISO 10272-1:2017).
Molecular Assessment
DNA was extracted from culture broth using a QIAamp DNA Mini Kit (Qiagen, Germany, GmbH Catalogue No. 51304). The extracted DNA was used in subsequent (PCR) assays for species confirmation and to detect genes responsible for virulence and antimicrobial agent resistance. PCR was performed in a final volume of 25 μL that contained 12.5 μL of EmeraldAmp MAX PCR Master Mix [EmeraldAmp GT (2× premix), Japan], 1 μL of each primer at concentrations of 20 pmol, 4.5 μL of diethyl pyrocarbonate water, and 6 μL of the DNA template. The reaction was performed in a Biometra thermal cycler, T3000 (Germany). The oligonucleotide primers (Table 1) were supplied by Metabion, Germany.
The PCR products were separated by electrophoresis according to (Sambrook et al.,1989) on a 1% agarose gel (AppliChem, Germany, GmbH) in 1× TBE buffer at room temperature using a gradient of 5 V/cm. Each well was loaded with 15 μL of the PCR product. A GelPilot 100 bp (Qiagen) ladder was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Biometra BDA digital, Germany), and the data were analyzed using a gel documentation system (Alpha Innotech, Biometra, Germany) and a piece of computer software (automatic image capture software, Protein Simple, formerly Cell Bioscience, USA). The temperature and time conditions of the primers during PCR are shown in Table (1).
The amplification efficiency was verified for positive field samples that might have the tested genes, which were previously examined in a veterinary quality control reference laboratory for poultry production, Animal Health research institute.
PCRAmplification:
The extracted DNA was further tested by Thermo two step PCR kit (Thermo scientific) for the presence of (cdtB, hipO, ceuE, and tetM )genes. The polymerase chain reactions were done according to the manual instruction of the PCR kit as following: 12.5ul PCR master mix, 1 ul of each primer with concentration 20 pmol, 5ul of DNA then complete the total volume to 20 ul with PCR grade water. The amplification condition ran as initial denaturation at 95 ˚C for 5 min for one cycle, 40 cycles for 3 following steps: denaturation at 95 ˚C for 45 sec.,annealing for 40 seconds at 54°C for cdtB, 59°C for hipO, 47°C for ceuE, 55°C for tet(M), extension at 72°C for 1 minute, and final extension at 72°C for 5 minutes.
The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature. A generuler 100 bp ladder (Fermentas, Thermofisher) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software.
Table 1. Oligonucleotide sequences and thermal profiles used in PCR Test target Tested gene Primer
|
Test target |
Gene |
Sequence |
Amplicon size |
Reference |
|
Tetracycline resistance |
tet(M) |
F: ACAGAAAGCTTATTATATAAC R: TGGCGTGTCTATGATGTTCAC |
171bp |
(Aminov et al., 2004) |
|
Virulence gene of Campylobacter |
cdtB |
F: CAC GGT TAA AAT CCC CTG CT R:GCA CTT GGA ATT TGC AAG GC |
495bp |
(González-Hein et al., 2013) |
|
Campylobacter jejuni |
(hipO) |
F:GACTTCGTGCAGATATGGATGCTT R : GCTATAACTATCCGAAGAAGCCATCA |
344bp |
(Persson and Olsen, 2005) |
|
Campylobacter coli |
ceuE |
F: ATG AAA AAA TAT TTA GTT TTT GCA R: ATT TTA TTA TTT GTA GCA GCG |
894bp |
(Nayak et al., 2005) |
Results
Campylobacter isolates were isolated from 16 out of 69 (23.2%) examined cloacal swabs which were collected from turkey farms in Giza and Sharkia governorates during the period from 2021 to 2022. All samples were biochemically identified and confirmed by PCR , the highest prevalence was C. coli which constituted 12 out 16 Campylobacter isolates (75%), while C. jejuni represented 4 out of 16 (25%) Campylobacter isolates as shown in Table (2).
Table ( 2): prevalence of C. jejuni and C. coli in turkey cloacal swabs in Giza and Sharkia governorates .
|
Positive samples by using Conventional cultural methods |
No. of positive samples |
No. of the examined samples |
Governorates |
||||
|
C. coli |
C. jejuni |
||||||
|
%** |
No. |
%** |
No. |
%* |
No. |
||
|
50 |
2 |
50 |
2 |
7.2 |
4 |
55 |
Sharkia |
|
83.3 |
10 |
16.7 |
2 |
85.7 |
12 |
14 |
Giza |
|
75 |
12 |
25 |
4 |
23.2 |
16 |
69 |
Total |
* % according to the total number of examined samples
** % according to the total number of positive Campylobacter isolates .
2-Molecular confirmation, typing and detection of cdtB and tetM of Campylobacter isolates.
All Campylobacter isolates were confirmed and typed by using multiplex PCR technique. The amplification of the DNA for hipO gene which used for detection C. jejuni and was found in 4 out 16 Campylobacter isolates (25%) . On the other hand, ceuE gene which used for detection of C. coli was found in 12 out of 16 (75%) of Campylobacter isolates, as shown in Table (2)
All Campylobacter strains showed positive amplification of cdtB virulent gene, while only 8 out of 16 (50%) of total Campylobacter isolates harboured tetM gene . The tetM gene was detected in 1 out of 4 (25%) of C. jejuni isolates and 7 out of 12(58.3%) of C. coli isolates as shown in Table (3).
Table (3) Distribution of tetracycline resistance gene (TetM) and cdtB gene in isolated Campylobacter strains
|
No. of Strain |
Type |
tetM gene
|
cdtB gene |
|
1 |
C .coli |
Positive |
Positive |
|
2 |
C . jejuni |
Positive |
Positive |
|
3 |
C .coli |
Negative |
Positive |
|
4 |
C .coli |
Negative |
Positive |
|
5 |
C .coli |
Negative |
Positive |
|
6 |
C .coli |
Positive |
Positive |
|
7 |
C .coli |
Positive |
Positive |
|
8 |
C .coli |
Positive |
Positive |
|
9 |
C . jejuni |
Negative |
Positive |
|
10 |
C .coli |
Negative |
Positive |
|
11 |
C . jejuni |
Negative |
Positive |
|
12 |
C .coli |
Positive |
Positive |
|
13 |
C .coli |
Negative |
Positive |
|
14 |
C .coli |
Positive |
Positive |
|
15 |
C . jejuni |
Negative |
Positive |
|
16 |
C .coli |
Positive |
Positive |
Discussion
Turkey meat is one of the consumed poultry meat in Egypt especially in occasion, which encourage us to identify potential microorganisms as Campylobacter. It is one of the most important food poisoning microorganism related to public health hazards in the last 20 years, as it has different ways to produce diseases through animals, contaminated food and one to one communication (Hakeem and Lu 2021).
In the present study, the investigation of the prevalence of Campylobacter in turkeys from turkey farms was done during the period from 2021 to 2022 in Giza and Sharkia governorates. On examination of a total of 69 cloacal swabs, 16 (23.2%) were positive for Campylobacter isolation, our result was in accordance with previous findings which recorded 22.5% Campylobacter from Delta governorates, Egypt (Khalil et al.,2020), and higher than that detected by Eid et al., (2018) who isolated Campylobacter in percentage of 16% of examined turkey farms in Sharkia, Egypt.
In this study the percentage of detection of C. coli was higher than the percentage of C. jejuni in examined turkey farms, this finding is contrary to that reported by Eid et al (2018) and Khalil et al., (2020) who reported that C. jejuni in high percentage than C. coli in examined Turkey farms in Sharkia and Delta governorates in Egypt .
Campylobacter can be differentiated by multiplex PCR through using hipO gene which is responsible for hippurate hydrolysis activity of C. jejuni (Linton et al., 1997), and ceuE which designed encoding a 34.5 to 36.2 KDa lipoprotein compound of binding-protein dependent transport system for sidrophore enterochelin characterized for C. coli (984bp) (Park and Richardson 1995; Richardson and Park 1995). Also ceuE gene has two primer (COL1 and COL2) were designed for identified C.coli only. (Gonzalez et al.,1997). Multiplex PCR is a rapid and accurate technique in Campylobacter detection and identification (El-Adawy et al., 2012). In this study we use hipO gene for confirmation of C. jejuni. Also, Khalil et al., (2020) and Karmi (2019) used the same gene in their studies for detection C. jejuni while Eid et al., (2018) and Gahamanyi et al., (2021) were used CJ gene for detection of C. jejuni in their studies. In the present investigation ceuE gene designed for detection of C. coli at 984bp was used. That was similar to the results of He et al., (2010); Rajagunalan et al., (2014); and Eid al al., (2018). On the other hand, Karmi (2019); and El Baaboua et al., (2022) used glyA and, cadF genes for detection of C. coli respectively.
Our study detected the cdtB gene which is one of virulence genes of Campylobacter spp. which responsible for production of Campylobacter cytolethal distending toxin. This gene was detected in 100% of Campylobacter isolates that nearly accord the result of Bang et al., (2004) who detected cdtB gene in 87.1% in Campylobacter species that isolated from turkeys while Kavan et al., (2015) detected the presence of cdtB gene in 6% of Campylobacter spp. isolated from turkeys in Iran.
The ribosomal protection genes (tetM, tetO, tetQ) are encoded on conjugative elements and many are encoded on transposons, but the vast majority is present on transferable plasmids. They have the widest host range and are found in a number of Gram-positive and Gram-negative bacteria (Chopra and Roberts, 2001; Roberts, 1996). Tetracycline resistance in Campylobacter spp. is primarily mediated by ribosomal production protein (tetO), which is transferred as plasmid-encoded gene (Gibreel et al.,2004). In the present tudy, the identification of a new class of tetracycline-resistant determinants in Campylobacter spp. like tet(M) gene was done. This gene might be transferred to Campylobacter spp. by means of a plasmid, by conjugative transposons (Hormeño et al., 2020). Our results are supportive of this finding and indicate a need for closer investigation of these interactions.
In conclusion